Antibody Rat Duox1

Lab Reagents

Human IgG antibody Laboratories manufactures the antibody rat duox1 reagents distributed by Genprice. The Antibody Rat Duox1 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact rat Antibody. Other Antibody products are available in stock. Specificity: Antibody Category: Rat Group: Duox1

Duox1 information

DUOX1 cloning plasmid
CSB-CL007228HU-10ug 10ug
EUR 1815
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4656
  • Sequence: ATGGGCTTCTGCCTGGCTCTAGCATGGACACTTCTGGTTGGGGCATGGACCCCTCTGGGAGCTCAGAACCCCATTTCGTGGGAGGTGCAGCGATTTGATGGGTGGTACAACAACCTCATGGAGCACAGATGGGGCAGCAAAGGCTCCCGGCTGCAGCGCCTGGTCCCAGCCAGCT
  • Show more
Description: A cloning plasmid for the DUOX1 gene.

DUOX1 Rabbit pAb
A8583-100ul 100 ul
EUR 308

DUOX1 Rabbit pAb
A8583-200ul 200 ul
EUR 459

DUOX1 Rabbit pAb
A8583-20ul 20 ul
EUR 183

DUOX1 Rabbit pAb
A8583-50ul 50 ul
EUR 223

Dual Oxidase 1 (DUOX1) Antibody
20-abx124235
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dual Oxidase 1 (DUOX1) Antibody
abx122404-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Dual Oxidase 1 (DUOX1) Antibody
20-abx321295
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dual Oxidase 1 (DUOX1) Antibody
abx432624-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Dual Oxidase 1 (DUOX1) Antibody
abx432626-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Anti-DUOX1 (aa972-985) antibody
STJ72649 100 µg
EUR 359

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5 1
EUR 1138

Duox1 sgRNA CRISPR Lentivector set (Rat)
K7384701 3 x 1.0 ug
EUR 339

DUOX1 ELISA KIT|Human
EF004880 96 Tests
EUR 689

Human DUOX1 shRNA Plasmid
20-abx959996
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Canine DUOX1 ELISA KIT
ELI-32267d 96 Tests
EUR 928

Rat Dual oxidase 1(DUOX1) ELISA kit
E02D0296-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dual oxidase 1(DUOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.