Lab Reagents
Human IgG antibody Laboratories manufactures the antibody rat duox1 reagents distributed by Genprice. The Antibody Rat Duox1 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact rat Antibody. Other Antibody products are available in stock. Specificity: Antibody Category: Rat Group: Duox1
Duox1 information
DUOX1 cloning plasmid |
CSB-CL007228HU-10ug |
Cusabio |
10ug |
EUR 1815 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4656
- Sequence: ATGGGCTTCTGCCTGGCTCTAGCATGGACACTTCTGGTTGGGGCATGGACCCCTCTGGGAGCTCAGAACCCCATTTCGTGGGAGGTGCAGCGATTTGATGGGTGGTACAACAACCTCATGGAGCACAGATGGGGCAGCAAAGGCTCCCGGCTGCAGCGCCTGGTCCCAGCCAGCT
- Show more
|
Description: A cloning plasmid for the DUOX1 gene. |
DUOX1 Rabbit pAb |
A8583-100ul |
Abclonal |
100 ul |
EUR 308 |
DUOX1 Rabbit pAb |
A8583-200ul |
Abclonal |
200 ul |
EUR 459 |
DUOX1 Rabbit pAb |
A8583-20ul |
Abclonal |
20 ul |
EUR 183 |
DUOX1 Rabbit pAb |
A8583-50ul |
Abclonal |
50 ul |
EUR 223 |
Dual Oxidase 1 (DUOX1) Antibody |
20-abx124235 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Dual Oxidase 1 (DUOX1) Antibody |
abx122404-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Dual Oxidase 1 (DUOX1) Antibody |
20-abx321295 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dual Oxidase 1 (DUOX1) Antibody |
abx432624-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Dual Oxidase 1 (DUOX1) Antibody |
abx432626-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol) |
RAT-5 |
Alpha Diagnostics |
1 |
EUR 1138 |
Duox1 sgRNA CRISPR Lentivector set (Rat) |
K7384701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human DUOX1 shRNA Plasmid |
20-abx959996 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat Dual oxidase 1(DUOX1) ELISA kit |
E02D0296-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Dual oxidase 1(DUOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |