Cd74 Elisa Duoset

Lab Reagents

Duoset Elisa Laboratories manufactures the cd74 elisa duoset reagents distributed by Genprice. The Cd74 Elisa Duoset reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact duoset elisa. Other Cd74 products are available in stock. Specificity: Cd74 Category: Elisa Group: Duoset

Duoset information

CD74 antibody

10R-CD74aHU 100 ug
EUR 404
Description: Mouse monoclonal CD74 antibody

CD74 Antibody

49365-100ul 100ul
EUR 333

CD74 Antibody

49365-50ul 50ul
EUR 239

CD74 Antibody

1-CSB-PA004956DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
Description: A polyclonal antibody against CD74. Recognizes CD74 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

Cd74 Antibody

1-CSB-PA004956LA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cd74. Recognizes Cd74 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

Cd74 Antibody

1-CSB-PA004956LA01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cd74. Recognizes Cd74 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

CD74 Antibody

1-CSB-PA005842
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CD74. Recognizes CD74 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CD74 Antibody

DF7449 200ul
EUR 304
Description: CD74 Antibody detects endogenous levels of total CD74.

CD74 protein

80R-4272 50 ug
EUR 435
Description: Recombinant Human CD74 protein with His tag

CD74 siRNA

20-abx900922
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD74 siRNA

20-abx911069
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD74 siRNA

20-abx911070
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD74 Antibody

ABD7449 100 ug
EUR 438

CD74 antibody

PAab09829 100 ug
EUR 386

anti-CD74

YF-PA10817 100 ug
EUR 403
Description: Rabbit polyclonal to CD74

CD74 ELISA Kit (Rat) (OKEH06182)

OKEH06182 96 Wells
EUR 779
Description: Description of target: Plays a critical role in MHC class II antigen processing by stabilizing peptide-free class II alpha/beta heterodimers in a complex soon after their synthesis and directing transport of the complex from the endoplasmic reticulum to compartments where peptide loading of class II takes place. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

CD74 Rabbit pAb

A13958-100ul 100 ul
EUR 308

CD74 Rabbit pAb

A13958-200ul 200 ul
EUR 459

CD74 Rabbit pAb

A13958-20ul 20 ul
EUR 183

CD74 Rabbit pAb

A13958-50ul 50 ul
EUR 223

Human CD74 Antibody

32119-05111 150 ug
EUR 261

CD74 Polyclonal Antibody

41836-100ul 100ul
EUR 252

CD74 Polyclonal Antibody

41836-50ul 50ul
EUR 187

CD74 Blocking Peptide

DF7449-BP 1mg
EUR 195

CD74, human recombinant

7317-100
EUR 370

CD74 Conjugated Antibody

C49365 100ul
EUR 397

CD74(BU45) Antibody

BNUB0189-100 100uL
EUR 209
Description: Primary antibody against CD74(BU45), Concentration: 0.2mg/mL

CD74(BU45) Antibody

BNUB0189-500 500uL
EUR 458
Description: Primary antibody against CD74(BU45), Concentration: 0.2mg/mL

CD74(BU45) Antibody

BNUM0189-50 50uL
EUR 395
Description: Primary antibody against CD74(BU45), 1mg/mL

CD74(BU45) Antibody

BNC040189-100 100uL
EUR 199
Description: Primary antibody against CD74(BU45), CF405S conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC040189-500 500uL
EUR 544
Description: Primary antibody against CD74(BU45), CF405S conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC610189-100 100uL
EUR 199
Description: Primary antibody against CD74(BU45), CF660R conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC610189-500 500uL
EUR 544
Description: Primary antibody against CD74(BU45), CF660R conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC470189-100 100uL
EUR 199
Description: Primary antibody against CD74(BU45), CF647 conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC470189-500 500uL
EUR 544
Description: Primary antibody against CD74(BU45), CF647 conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC550189-100 100uL
EUR 199
Description: Primary antibody against CD74(BU45), CF555 conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC550189-500 500uL
EUR 544
Description: Primary antibody against CD74(BU45), CF555 conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC050189-100 100uL
EUR 199
Description: Primary antibody against CD74(BU45), CF405M conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC050189-500 500uL
EUR 544
Description: Primary antibody against CD74(BU45), CF405M conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC400189-100 100uL
EUR 199
Description: Primary antibody against CD74(BU45), CF640R conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC400189-500 500uL
EUR 544
Description: Primary antibody against CD74(BU45), CF640R conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC430189-100 100uL
EUR 199
Description: Primary antibody against CD74(BU45), CF543 conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC430189-500 500uL
EUR 544
Description: Primary antibody against CD74(BU45), CF543 conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC800189-100 100uL
EUR 199
Description: Primary antibody against CD74(BU45), CF680 conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC800189-500 500uL
EUR 544
Description: Primary antibody against CD74(BU45), CF680 conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC810189-100 100uL
EUR 199
Description: Primary antibody against CD74(BU45), CF680R conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC810189-500 500uL
EUR 544
Description: Primary antibody against CD74(BU45), CF680R conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNCP0189-250 250uL
EUR 383
Description: Primary antibody against CD74(BU45), PerCP conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNCR0189-250 250uL
EUR 383
Description: Primary antibody against CD74(BU45), RPE conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNCA0189-250 250uL
EUR 383
Description: Primary antibody against CD74(BU45), APC conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNCAP0189-100 100uL
EUR 199
Description: Primary antibody against CD74(BU45), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNCAP0189-500 500uL
EUR 544
Description: Primary antibody against CD74(BU45), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNCH0189-100 100uL
EUR 199
Description: Primary antibody against CD74(BU45), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNCH0189-500 500uL
EUR 544
Description: Primary antibody against CD74(BU45), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC940189-100 100uL
EUR 199
Description: Primary antibody against CD74(BU45), CF594 conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC940189-500 500uL
EUR 544
Description: Primary antibody against CD74(BU45), CF594 conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC700189-100 100uL
EUR 199
Description: Primary antibody against CD74(BU45), CF770 conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC700189-500 500uL
EUR 544
Description: Primary antibody against CD74(BU45), CF770 conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNCB0189-100 100uL
EUR 199
Description: Primary antibody against CD74(BU45), Biotin conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNCB0189-500 500uL
EUR 544
Description: Primary antibody against CD74(BU45), Biotin conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC880189-100 100uL
EUR 199
Description: Primary antibody against CD74(BU45), CF488A conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC880189-500 500uL
EUR 544
Description: Primary antibody against CD74(BU45), CF488A conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC680189-100 100uL
EUR 199
Description: Primary antibody against CD74(BU45), CF568 conjugate, Concentration: 0.1mg/mL

CD74(BU45) Antibody

BNC680189-500 500uL
EUR 544
Description: Primary antibody against CD74(BU45), CF568 conjugate, Concentration: 0.1mg/mL

Monoclonal CD74 Antibody

AMM04344G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human CD74. The antibodies are raised in Mouse. This antibody is applicable in FC, WB

CD74 cloning plasmid

CSB-CL004956HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 699
  • Sequence: atgcacaggaggagaagcaggagctgtcgggaagatcagaagccagtcatggatgaccagcgcgaccttatctccaacaatgagcaactgcccatgctgggccggcgccctggggccccggagagcaagtgcagccgcggagccctgtacacaggcttttccatcctggtgactct
  • Show more
Description: A cloning plasmid for the CD74 gene.

CD74 Polyclonal Antibody

ABP53195-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD74
  • Applications tips:
Description: A polyclonal antibody for detection of CD74 from Human. This CD74 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD74

CD74 Polyclonal Antibody

ABP53195-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD74
  • Applications tips:
Description: A polyclonal antibody for detection of CD74 from Human. This CD74 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD74

CD74 Polyclonal Antibody

ABP53195-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD74
  • Applications tips:
Description: A polyclonal antibody for detection of CD74 from Human. This CD74 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD74

CD74 Rabbit pAb

A5667-100ul 100 ul
EUR 308

CD74 Rabbit pAb

A5667-200ul 200 ul
EUR 459

CD74 Rabbit pAb

A5667-20ul 20 ul
EUR 183

CD74 Rabbit pAb

A5667-50ul 50 ul
EUR 223

Cd74 Polyclonal Antibody

A54780 100 µg
EUR 570.55
Description: fast delivery possible

Cd74 Polyclonal Antibody

A55559 100 µg
EUR 570.55
Description: kits suitable for this type of research

CD74 Polyclonal Antibody

ES4194-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD74 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CD74 Polyclonal Antibody

ES4194-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD74 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

anti- CD74 antibody

FNab09829 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:6000
  • Immunogen: CD74
  • Uniprot ID: P04233
  • Gene ID: 972
  • Research Area: Immunology
Description: Antibody raised against CD74

Anti-CD74 antibody

STJ27634 100 µl
EUR 277
Description: The protein encoded by this gene associates with class II major histocompatibility complex (MHC) and is an important chaperone that regulates antigen presentation for immune response. It also serves as cell surface receptor for the cytokine macrophage migration inhibitory factor (MIF) which, when bound to the encoded protein, initiates survival pathways and cell proliferation. This protein also interacts with amyloid precursor protein (APP) and suppresses the production of amyloid beta (Abeta). Multiple alternatively spliced transcript variants encoding different isoforms have been identified.

Anti-CD74 antibody

STJ115893 100 µl
EUR 277
Description: The protein encoded by this gene associates with class II major histocompatibility complex (MHC) and is an important chaperone that regulates antigen presentation for immune response. It also serves as cell surface receptor for the cytokine macrophage migration inhibitory factor (MIF) which, when bound to the encoded protein, initiates survival pathways and cell proliferation. This protein also interacts with amyloid precursor protein (APP) and suppresses the production of amyloid beta (Abeta). Multiple alternatively spliced transcript variants encoding different isoforms have been identified.

Anti-CD74 antibody

STJ16101044 100 µg
EUR 354

Anti-CD74 antibody

STJ73084 100 µg
EUR 359

Anti-CD74 antibody

STJ190022 200 µl
EUR 197
Description: Unconjugated Mouse monoclonal to CD74 (3D2)

Anti-CD74 antibody

STJ96829 200 µl
EUR 197
Description: Rabbit polyclonal to CD74.

Anti-CD74 (1D1)

YF-MA12350 200 ul
EUR 363
Description: Mouse monoclonal to CD74

Cd74 Antibody, HRP conjugated

1-CSB-PA004956LB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cd74. Recognizes Cd74 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Cd74 Antibody, HRP conjugated

1-CSB-PA004956LB01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cd74. Recognizes Cd74 from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Cd74 Antibody, FITC conjugated

1-CSB-PA004956LC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cd74. Recognizes Cd74 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Cd74 Antibody, FITC conjugated

1-CSB-PA004956LC01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cd74. Recognizes Cd74 from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Cd74 Antibody, Biotin conjugated

1-CSB-PA004956LD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cd74. Recognizes Cd74 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Cd74 Antibody, Biotin conjugated

1-CSB-PA004956LD01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cd74. Recognizes Cd74 from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

CD74 protein (His tag)

80R-2809 100 ug
EUR 322
Description: Purified recombinant CD74 protein (His tag)

Rat CD74 shRNA Plasmid

20-abx985153
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CD74(CLIP/813) Antibody

BNUM0813-50 50uL
EUR 395
Description: Primary antibody against CD74(CLIP/813), 1mg/mL

CD74(CLIP/1133) Antibody

BNUM1133-50 50uL
EUR 395
Description: Primary antibody against CD74(CLIP/1133), 1mg/mL

CD74(LN-2) Antibody

BNUB0056-100 100uL
EUR 209
Description: Primary antibody against CD74(LN-2), Concentration: 0.2mg/mL

CD74(LN-2) Antibody

BNUB0056-500 500uL
EUR 458
Description: Primary antibody against CD74(LN-2), Concentration: 0.2mg/mL

CD74(CLIP/813) Antibody

BNUB0813-100 100uL
EUR 209
Description: Primary antibody against CD74(CLIP/813), Concentration: 0.2mg/mL

CD74(CLIP/813) Antibody

BNUB0813-500 500uL
EUR 458
Description: Primary antibody against CD74(CLIP/813), Concentration: 0.2mg/mL

CD74(CLIP/1133) Antibody

BNUB1133-100 100uL
EUR 209
Description: Primary antibody against CD74(CLIP/1133), Concentration: 0.2mg/mL

CD74(CLIP/1133) Antibody

BNUB1133-500 500uL
EUR 458
Description: Primary antibody against CD74(CLIP/1133), Concentration: 0.2mg/mL

CD74(LN-2) Antibody

BNUM0056-50 50uL
EUR 395
Description: Primary antibody against CD74(LN-2), 1mg/mL

CD74(LN-2) Antibody

BNC040056-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2), CF405S conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC040056-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2), CF405S conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC040813-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/813), CF405S conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC040813-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/813), CF405S conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC550813-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/813), CF555 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC550813-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/813), CF555 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC551133-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/1133), CF555 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC551133-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/1133), CF555 conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC610056-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2), CF660R conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC610056-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2), CF660R conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC610813-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/813), CF660R conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC610813-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/813), CF660R conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC611133-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/1133), CF660R conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC611133-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/1133), CF660R conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC470056-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2), CF647 conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC470056-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2), CF647 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC470813-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/813), CF647 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC470813-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/813), CF647 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC471133-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/1133), CF647 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC471133-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/1133), CF647 conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC550056-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2), CF555 conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC550056-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2), CF555 conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC050056-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2), CF405M conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC050056-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2), CF405M conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC050813-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/813), CF405M conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC050813-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/813), CF405M conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC051133-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/1133), CF405M conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC051133-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/1133), CF405M conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC400056-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2), CF640R conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC400056-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2), CF640R conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC400813-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/813), CF640R conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC400813-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/813), CF640R conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC401133-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/1133), CF640R conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC401133-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/1133), CF640R conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC430056-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2), CF543 conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC430056-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2), CF543 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC430813-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/813), CF543 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC430813-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/813), CF543 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC431133-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/1133), CF543 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC431133-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/1133), CF543 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC041133-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/1133), CF405S conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC041133-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/1133), CF405S conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC800056-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2), CF680 conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC800056-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2), CF680 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC800813-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/813), CF680 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC800813-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/813), CF680 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC801133-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/1133), CF680 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC801133-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/1133), CF680 conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC810056-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2), CF680R conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC810056-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2), CF680R conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNCP0056-250 250uL
EUR 383
Description: Primary antibody against CD74(LN-2), PerCP conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNCP0813-250 250uL
EUR 383
Description: Primary antibody against CD74(CLIP/813), PerCP conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNCP1133-250 250uL
EUR 383
Description: Primary antibody against CD74(CLIP/1133), PerCP conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNCR0056-250 250uL
EUR 383
Description: Primary antibody against CD74(LN-2), RPE conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNCR0813-250 250uL
EUR 383
Description: Primary antibody against CD74(CLIP/813), RPE conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNCR1133-250 250uL
EUR 383
Description: Primary antibody against CD74(CLIP/1133), RPE conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNCA0056-250 250uL
EUR 383
Description: Primary antibody against CD74(LN-2), APC conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNCA0813-250 250uL
EUR 383
Description: Primary antibody against CD74(CLIP/813), APC conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNCA1133-250 250uL
EUR 383
Description: Primary antibody against CD74(CLIP/1133), APC conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNCAP0056-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNCAP0056-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNCAP0813-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/813), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNCAP0813-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/813), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNCB0813-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/813), Biotin conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNCB0813-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/813), Biotin conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNCB1133-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/1133), Biotin conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNCB1133-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/1133), Biotin conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNCH0056-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNCH0056-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNCH0813-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/813), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNCH0813-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/813), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNCH1133-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/1133), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNCH1133-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/1133), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC880813-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/813), CF488A conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC880813-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/813), CF488A conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC881133-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/1133), CF488A conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC881133-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/1133), CF488A conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC940056-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2), CF594 conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC940056-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2), CF594 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC940813-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/813), CF594 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC940813-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/813), CF594 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC941133-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/1133), CF594 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC941133-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/1133), CF594 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC680813-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/813), CF568 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC680813-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/813), CF568 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC681133-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/1133), CF568 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC681133-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/1133), CF568 conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC700056-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2), CF770 conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC700056-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2), CF770 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC700813-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/813), CF770 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC700813-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/813), CF770 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC701133-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/1133), CF770 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC701133-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/1133), CF770 conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNCAP1133-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/1133), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNCAP1133-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/1133), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNCB0056-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2), Biotin conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNCB0056-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2), Biotin conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC880056-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2), CF488A conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC880056-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2), CF488A conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC810813-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/813), CF680R conjugate, Concentration: 0.1mg/mL

CD74(CLIP/813) Antibody

BNC810813-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/813), CF680R conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC811133-100 100uL
EUR 199
Description: Primary antibody against CD74(CLIP/1133), CF680R conjugate, Concentration: 0.1mg/mL

CD74(CLIP/1133) Antibody

BNC811133-500 500uL
EUR 544
Description: Primary antibody against CD74(CLIP/1133), CF680R conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC680056-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2), CF568 conjugate, Concentration: 0.1mg/mL

CD74(LN-2) Antibody

BNC680056-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2), CF568 conjugate, Concentration: 0.1mg/mL

Human CD74 shRNA Plasmid

20-abx950693
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CD74 shRNA Plasmid

20-abx971001
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CD74 Monoclonal Antibody [RMC956A]

A68442 100 µl
EUR 628.55
Description: reagents widely cited

Anti-CD74 Monoclonal Antibody

M01340 100ug
EUR 397
Description: Mouse Monoclonal CD74 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse.

CD74 Human Recombinant Protein

PROTP04233 Regular: 20ug
EUR 317
Description: CD74 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 183 amino acids (73-232 a.a) and having a molecular mass of 20.6kDa.

CD74 Recombinant Protein (Human)

RP006415 100 ug Ask for price

CD74 Recombinant Protein (Rat)

RP194024 100 ug Ask for price

CD74 Recombinant Protein (Mouse)

RP122696 100 ug Ask for price

CD74 Recombinant Protein (Mouse)

RP122699 100 ug Ask for price

Monoclonal antibody for CD74

SMC-116C 0.025mg
EUR 174
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is not conjugated.

Monoclonal antibody for CD74

SMC-116D 0.1mg
EUR 296
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is not conjugated.

Monoclonal antibody for CD74

SMC-116D-A390 0.1mg
EUR 343
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with ATTO 390.

Monoclonal antibody for CD74

SMC-116D-A488 0.1mg
EUR 342
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with ATTO 488.

Monoclonal antibody for CD74

SMC-116D-A565 0.1mg
EUR 342
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with ATTO 565.

Monoclonal antibody for CD74

SMC-116D-A594 0.1mg
EUR 342
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with ATTO 594.

Monoclonal antibody for CD74

SMC-116D-A633 0.1mg
EUR 342
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with ATTO 633.

Monoclonal antibody for CD74

SMC-116D-A655 0.1mg
EUR 342
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with ATTO 655.

Monoclonal antibody for CD74

SMC-116D-A680 0.1mg
EUR 342
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with ATTO 680.

Monoclonal antibody for CD74

SMC-116D-A700 0.1mg
EUR 342
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with ATTO 700.

Monoclonal antibody for CD74

SMC-116D-ALP 0.1mg
EUR 336
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for CD74

SMC-116D-APC 0.1mg
EUR 341
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with APC.

Monoclonal antibody for CD74

SMC-116D-APCCY7 0.1mg
EUR 413
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with APC/Cy7.

Monoclonal antibody for CD74

SMC-116D-BI 0.1mg
EUR 338
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with Biotin.

Monoclonal antibody for CD74

SMC-116D-DY350 0.1mg
EUR 357
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with Dylight 350.

Monoclonal antibody for CD74

SMC-116D-DY405 0.1mg
EUR 345
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with Dylight 405.

Monoclonal antibody for CD74

SMC-116D-DY488 0.1mg
EUR 335
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with Dylight 488.

Monoclonal antibody for CD74

SMC-116D-DY594 0.1mg
EUR 337
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with Dylight 594.

Monoclonal antibody for CD74

SMC-116D-DY633 0.1mg
EUR 332
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with Dylight 633.

Monoclonal antibody for CD74

SMC-116D-FITC 0.1mg
EUR 334
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with FITC.

Monoclonal antibody for CD74

SMC-116D-HRP 0.1mg
EUR 330
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with HRP.

Monoclonal antibody for CD74

SMC-116D-P594 0.1mg
EUR 349
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with PE/ATTO 594.

Monoclonal antibody for CD74

SMC-116D-PCP 0.1mg
EUR 341
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with PerCP.

Monoclonal antibody for CD74

SMC-116D-RPE 0.1mg
EUR 339
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Mouse | Rat | Bovine | Dog | Hamster | Monkey | Guinea Pig (Cavia porcellus) | Sheep | Pig | African clawed frog (Xenopus laevis) | Mollusk | Mussel (Perna viridis) CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with RPE.

Monoclonal antibody for CD74

SMC-116D-STR 0.1mg
EUR 340
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Rat | Mouse | Bovine | Fungi CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is conjugated with Streptavidin.

Monoclonal antibody for CD74

SMC-116S 0.012mg
EUR 65
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone PIN.1 against Human | Rat | Mouse | Bovine | Fungi CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide. The antibody is tested and validated for WB, IHC, ICC/IF, IP, FCM, FACS assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:50). This MAb for CD74 is not conjugated.

Monoclonal antibody for CD74

SMC-267D 0.1mg
EUR 353
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is not conjugated.

Monoclonal antibody for CD74

SMC-267D-A390 0.1mg
EUR 400
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with ATTO 390.

Monoclonal antibody for CD74

SMC-267D-A488 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with ATTO 488.

Monoclonal antibody for CD74

SMC-267D-A565 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with ATTO 565.

Monoclonal antibody for CD74

SMC-267D-A594 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with ATTO 594.

Monoclonal antibody for CD74

SMC-267D-A633 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with ATTO 633.

Monoclonal antibody for CD74

SMC-267D-A655 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with ATTO 655.

Monoclonal antibody for CD74

SMC-267D-A680 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with ATTO 680.

Monoclonal antibody for CD74

SMC-267D-A700 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with ATTO 700.

Monoclonal antibody for CD74

SMC-267D-ALP 0.1mg
EUR 393
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for CD74

SMC-267D-APC 0.1mg
EUR 398
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with APC.

Monoclonal antibody for CD74

SMC-267D-APCCY7 0.1mg
EUR 470
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with APC/Cy7.

Monoclonal antibody for CD74

SMC-267D-BI 0.1mg
EUR 395
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with Biotin.

Monoclonal antibody for CD74

SMC-267D-DY350 0.1mg
EUR 413
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with Dylight 350.

Monoclonal antibody for CD74

SMC-267D-DY405 0.1mg
EUR 402
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with Dylight 405.

Monoclonal antibody for CD74

SMC-267D-DY488 0.1mg
EUR 392
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with Dylight 488.

Monoclonal antibody for CD74

SMC-267D-DY594 0.1mg
EUR 394
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with Dylight 594.

Monoclonal antibody for CD74

SMC-267D-DY633 0.1mg
EUR 389
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with Dylight 633.

Monoclonal antibody for CD74

SMC-267D-FITC 0.1mg
EUR 391
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with FITC.

Monoclonal antibody for CD74

SMC-267D-HRP 0.1mg
EUR 387
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with HRP.

Monoclonal antibody for CD74

SMC-267D-P594 0.1mg
EUR 406
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with PE/ATTO 594.

Monoclonal antibody for CD74

SMC-267D-PCP 0.1mg
EUR 398
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with PerCP.

Monoclonal antibody for CD74

SMC-267D-RPE 0.1mg
EUR 396
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with RPE.

Monoclonal antibody for CD74

SMC-267D-STR 0.1mg
EUR 397
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with Streptavidin.

Monoclonal antibody for CD74

SMC-267S 0.012mg
EUR 65
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 1B8 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is not conjugated.

Monoclonal antibody for CD74

SMC-268D 0.1mg
EUR 353
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is not conjugated.

Monoclonal antibody for CD74

SMC-268D-A390 0.1mg
EUR 400
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with ATTO 390.

Monoclonal antibody for CD74

SMC-268D-A488 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with ATTO 488.

Monoclonal antibody for CD74

SMC-268D-A565 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with ATTO 565.

Monoclonal antibody for CD74

SMC-268D-A594 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with ATTO 594.

Monoclonal antibody for CD74

SMC-268D-A633 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with ATTO 633.

Monoclonal antibody for CD74

SMC-268D-A655 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with ATTO 655.

Monoclonal antibody for CD74

SMC-268D-A680 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with ATTO 680.

Monoclonal antibody for CD74

SMC-268D-A700 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with ATTO 700.

Monoclonal antibody for CD74

SMC-268D-ALP 0.1mg
EUR 393
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for CD74

SMC-268D-APC 0.1mg
EUR 398
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with APC.

Monoclonal antibody for CD74

SMC-268D-APCCY7 0.1mg
EUR 470
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with APC/Cy7.

Monoclonal antibody for CD74

SMC-268D-BI 0.1mg
EUR 395
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with Biotin.

Monoclonal antibody for CD74

SMC-268D-DY350 0.1mg
EUR 413
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with Dylight 350.

Monoclonal antibody for CD74

SMC-268D-DY405 0.1mg
EUR 402
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with Dylight 405.

Monoclonal antibody for CD74

SMC-268D-DY488 0.1mg
EUR 392
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with Dylight 488.

Monoclonal antibody for CD74

SMC-268D-DY594 0.1mg
EUR 394
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with Dylight 594.

Monoclonal antibody for CD74

SMC-268D-DY633 0.1mg
EUR 389
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with Dylight 633.

Monoclonal antibody for CD74

SMC-268D-FITC 0.1mg
EUR 391
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with FITC.

Monoclonal antibody for CD74

SMC-268D-HRP 0.1mg
EUR 387
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with HRP.

Monoclonal antibody for CD74

SMC-268D-P594 0.1mg
EUR 406
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with PE/ATTO 594.

Monoclonal antibody for CD74

SMC-268D-PCP 0.1mg
EUR 398
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with PerCP.

Monoclonal antibody for CD74

SMC-268D-RPE 0.1mg
EUR 396
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with RPE.

Monoclonal antibody for CD74

SMC-268D-STR 0.1mg
EUR 397
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is conjugated with Streptavidin.

Monoclonal antibody for CD74

SMC-268S 0.012mg
EUR 65
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 3D7 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human CD74 invariant chain synthetic peptide.. The antibody is tested and validated for WB, FCM, FACS assays with the following recommended dilutions: WB (1:1000); FACS (1:50). This MAb for CD74 is not conjugated.

Monoclonal antibody for CD74

SMC-269D 0.1mg
EUR 353
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is not conjugated.

Monoclonal antibody for CD74

SMC-269D-A390 0.1mg
EUR 400
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with ATTO 390.

Monoclonal antibody for CD74

SMC-269D-A488 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with ATTO 488.

Monoclonal antibody for CD74

SMC-269D-A565 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with ATTO 565.

Monoclonal antibody for CD74

SMC-269D-A594 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with ATTO 594.

Monoclonal antibody for CD74

SMC-269D-A633 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with ATTO 633.

Monoclonal antibody for CD74

SMC-269D-A655 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with ATTO 655.

Monoclonal antibody for CD74

SMC-269D-A680 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with ATTO 680.

Monoclonal antibody for CD74

SMC-269D-A700 0.1mg
EUR 399
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with ATTO 700.

Monoclonal antibody for CD74

SMC-269D-ALP 0.1mg
EUR 393
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for CD74

SMC-269D-APC 0.1mg
EUR 398
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with APC.

Monoclonal antibody for CD74

SMC-269D-APCCY7 0.1mg
EUR 470
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with APC/Cy7.

Monoclonal antibody for CD74

SMC-269D-BI 0.1mg
EUR 395
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with Biotin.

Monoclonal antibody for CD74

SMC-269D-DY350 0.1mg
EUR 413
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with Dylight 350.

Monoclonal antibody for CD74

SMC-269D-DY405 0.1mg
EUR 402
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with Dylight 405.

Monoclonal antibody for CD74

SMC-269D-DY488 0.1mg
EUR 392
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with Dylight 488.

Monoclonal antibody for CD74

SMC-269D-DY594 0.1mg
EUR 394
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with Dylight 594.

Monoclonal antibody for CD74

SMC-269D-DY633 0.1mg
EUR 389
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with Dylight 633.

Monoclonal antibody for CD74

SMC-269D-FITC 0.1mg
EUR 391
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with FITC.

Monoclonal antibody for CD74

SMC-269D-HRP 0.1mg
EUR 387
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with HRP.

Monoclonal antibody for CD74

SMC-269D-P594 0.1mg
EUR 406
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Mouse | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with PE/ATTO 594.

Monoclonal antibody for CD74

SMC-269D-PCP 0.1mg
EUR 398
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with PerCP.

Monoclonal antibody for CD74

SMC-269D-RPE 0.1mg
EUR 396
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with RPE.

Monoclonal antibody for CD74

SMC-269D-STR 0.1mg
EUR 397
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is conjugated with Streptavidin.

Monoclonal antibody for CD74

SMC-269S 0.012mg
EUR 65
  • CD74 is a non-polymorphic type II integral membrane protein. It has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region and an approximately 150-aa lumenal domain (1). The CD74 chain is thought to fu
  • Show more
Description: A monoclonal antibody from clone 6D9 against Human | Rat CD74. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide corresponding to the N-terminal (1-100 aa) of human CD74 conjugated to KLH. Overlaps 100% with all 3 isoforms. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This MAb for CD74 is not conjugated.

Anti-Human CD74 antibody

STJ16100455 1 mL
EUR 650

CD74 ELISA Kit (Human) : 96 Wells (OKEH02313)

OKEH02313 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene associates with class II major histocompatibility complex (MHC) and is an important chaperone that regulates antigen presentation for immune response. It also serves as cell surface receptor for the cytokine macrophage migration inhibitory factor (MIF) which, when bound to the encoded protein, initiates survival pathways and cell proliferation. This protein also interacts with amyloid precursor protein (APP) and suppresses the production of amyloid beta (Abeta). Multiple alternatively spliced transcript variants encoding different isoforms have been identified. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

Human CD74 Antibody (Biotin Conjugate)

32119-05121 150 ug
EUR 369

Monoclonal CD74 Antibody, Clone: 2D1B11

APR15355G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human CD74. The antibodies are raised in Mouse and are from clone 2D1B11. This antibody is applicable in WB, FC, E

Monoclonal CD74 Antibody, Clone: 1267CT820.116.140.154

AMM02483G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human CD74. The antibodies are raised in Mouse and are from clone 1267CT820.116.140.154. This antibody is applicable in WB, FC, E

Monoclonal CD74 Antibody, Clone: 2D1B3

AMM02945G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human CD74. The antibodies are raised in Mouse and are from clone 2D1B3. This antibody is applicable in WB, FC, ICC, E

Cd74 Polyclonal Antibody, Biotin Conjugated

A54777 100 µg
EUR 570.55
Description: kits suitable for this type of research

Cd74 Polyclonal Antibody, FITC Conjugated

A54778 100 µg
EUR 570.55
Description: fast delivery possible

Cd74 Polyclonal Antibody, HRP Conjugated

A54779 100 µg
EUR 570.55
Description: reagents widely cited

Cd74 Polyclonal Antibody, HRP Conjugated

A55560 100 µg
EUR 570.55
Description: fast delivery possible

Cd74 Polyclonal Antibody, FITC Conjugated

A55561 100 µg
EUR 570.55
Description: reagents widely cited

Cd74 Polyclonal Antibody, Biotin Conjugated

A55562 100 µg
EUR 570.55
Description: Ask the seller for details

Anti-CD74 Rabbit Monoclonal Antibody

M01340-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD74 Antibody. Validated in IF, WB and tested in Human.

Cd74 ORF Vector (Rat) (pORF)

ORF064676 1.0 ug DNA
EUR 506

m CD74 inducible lentiviral particles

LVP546 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made optional inducible lentiviral particles for expressing mouse target: m CD74 (alternative name: CLIP; DHLAG; HLADG; Ia-GAMMA; Ii). The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_010545. Particles also contains a RFP-Blasticidin dual selection marker.

CD74 ORF Vector (Human) (pORF)

ORF002139 1.0 ug DNA
EUR 95

Cd74 ORF Vector (Mouse) (pORF)

ORF040900 1.0 ug DNA
EUR 506

Cd74 ORF Vector (Mouse) (pORF)

ORF040901 1.0 ug DNA
EUR 506

Anti-CD74 (aa159-171) antibody

STJ73085 100 µg
EUR 359

Human CD74 AssayLite Antibody (FITC Conjugate)

32119-05141 150 ug
EUR 428

Human CD74 AssayLite Antibody (RPE Conjugate)

32119-05151 150 ug
EUR 428

Human CD74 AssayLite Antibody (APC Conjugate)

32119-05161 150 ug
EUR 428

Human CD74 AssayLite Antibody (PerCP Conjugate)

32119-05171 150 ug
EUR 471

Human CellExp? CD74/DHLAG, human recombinant

7387-10
EUR 278

Human CellExp? CD74/DHLAG, human recombinant

7387-50
EUR 751

CD74; Clone LN2 (Ready-To-Use)

A00048-0002 2 ml
EUR 84

CD74; Clone LN2 (Ready-To-Use)

A00048-0007 7 ml
EUR 116

CD74; Clone LN2 (Ready-To-Use)

A00048-0025 25 ml
EUR 245

Cluster of Differentiation 74 (CD74) Antibody

20-abx110417
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cluster of Differentiation 74 (CD74) Antibody

20-abx109848
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Anti Human Cd74 Monoclonal Antibody

CABT-51815MH 0.2 mg
EUR 741

Recombinant Mouse HLADG/CD74 (C-6His)

CM13-10ug 10ug
EUR 126
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Mouse HLADG/CD74 (C-6His)

CM13-1mg 1mg
EUR 1877
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Mouse HLADG/CD74 (C-6His)

CM13-500ug 500ug
EUR 1328
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Mouse HLADG/CD74 (C-6His)

CM13-50ug 50ug
EUR 232
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Anti-CD74 (Milatuzumab)-SMCC-DM1 ADC

ADC-W-2548 1mg Ask for price
Description: This ADC product is comprised of an anti-CD74 monoclonal antibody conjugated via a SMCC linker to DM1

Anti-CD74 (Milatuzumab)-SPDB-DM4 ADC

ADC-W-2549 1mg Ask for price
Description: This ADC product is comprised of an anti-CD74 monoclonal antibody conjugated via a SPDB linker to DM4

Anti-CD74 (Milatuzumab)-MC-MMAF ADC

ADC-W-2550 1mg Ask for price
Description: This ADC product is comprised of an anti-CD74 monoclonal antibody conjugated via a MC linker to MMAF

CD74(LN-2 + CLIP/813) Antibody

BNUM1207-50 50uL
EUR 395
Description: Primary antibody against CD74(LN-2 + CLIP/813), 1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNUB1207-100 100uL
EUR 209
Description: Primary antibody against CD74(LN-2 + CLIP/813), Concentration: 0.2mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNUB1207-500 500uL
EUR 458
Description: Primary antibody against CD74(LN-2 + CLIP/813), Concentration: 0.2mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC551207-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF555 conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC551207-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF555 conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC611207-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF660R conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC611207-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF660R conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC471207-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF647 conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC471207-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF647 conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC051207-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF405M conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC051207-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF405M conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC401207-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF640R conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC401207-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF640R conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC431207-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF543 conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC431207-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF543 conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC041207-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF405S conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC041207-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF405S conjugate, Concentration: 0.1mg/mL

Cluster of Differentiation 74 (CD74) Antibody

abx414279-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Cluster of Differentiation 74 (CD74) Antibody

abx432479-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Cluster of Differentiation 74 (CD74) Antibody

abx432480-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

CD74(LN-2 + CLIP/813) Antibody

BNC801207-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF680 conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC801207-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF680 conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNCP1207-250 250uL
EUR 383
Description: Primary antibody against CD74(LN-2 + CLIP/813), PerCP conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNCR1207-250 250uL
EUR 383
Description: Primary antibody against CD74(LN-2 + CLIP/813), RPE conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNCA1207-250 250uL
EUR 383
Description: Primary antibody against CD74(LN-2 + CLIP/813), APC conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNCB1207-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2 + CLIP/813), Biotin conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNCB1207-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2 + CLIP/813), Biotin conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNCH1207-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2 + CLIP/813), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNCH1207-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2 + CLIP/813), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC881207-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF488A conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC881207-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF488A conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC941207-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF594 conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC941207-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF594 conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC681207-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF568 conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC681207-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF568 conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC701207-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF770 conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC701207-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF770 conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNCAP1207-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2 + CLIP/813), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNCAP1207-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2 + CLIP/813), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC811207-100 100uL
EUR 199
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF680R conjugate, Concentration: 0.1mg/mL

CD74(LN-2 + CLIP/813) Antibody

BNC811207-500 500uL
EUR 544
Description: Primary antibody against CD74(LN-2 + CLIP/813), CF680R conjugate, Concentration: 0.1mg/mL

Cd74 sgRNA CRISPR Lentivector set (Mouse)

K4979601 3 x 1.0 ug
EUR 339

Cd74 sgRNA CRISPR Lentivector set (Rat)

K6656301 3 x 1.0 ug
EUR 339

CD74 sgRNA CRISPR Lentivector set (Human)

K0000301 3 x 1.0 ug
EUR 339

h CD74 (6His) inducible lentiviral particles

LVP1100 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing C-terminal His-Tagged human target: CD74 (6His) (human CD74 molecule), [alternative names: DHLAG; HLADG; Ia-GAMMA; II]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_004355.3. It contains a RFP-Blasticidin dual selection marker.

Human, CD74 Human Recombinant Protein, Sf9

PROTP04233-1 Regular: 10ug
EUR 317
Description: CD74 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 166 amino acids (73-232a.a.) and having a molecular mass of 19.05kDa (Molecular size on SDS-PAGE will appear at approximately 18-28kDa). CD74 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Cd74 ELISA Kit| Rat HLA class II histocompatibility antigen gam

EF018446 96 Tests
EUR 689

Cd74 ELISA Kit| Mouse HLA class II histocompatibility antigen g

EF014436 96 Tests
EUR 689

Anti-CD74 Antibody Clone SPM523, Unconjugated-100ug

972-MSM1X-P1 100ug
EUR 428

Cluster Of Differentiation 74 (CD74) Antibody (Biotin)

20-abx105490
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cluster Of Differentiation 74 (CD74) Antibody (Biotin)

20-abx106137
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cluster Of Differentiation 74 (CD74) Antibody (FITC)

20-abx106907
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cluster Of Differentiation 74 (CD74) Antibody (FITC)

20-abx107551
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug