Invivogen Thp1 Dual Trex1

Lab Reagents

Human IgG antibody Laboratories manufactures the invivogen thp1 dual trex1 reagents distributed by Genprice. The Invivogen Thp1 Dual Trex1 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact InVivoGen. Other Invivogen products are available in stock. Specificity: Invivogen Category: Thp1 Group: Dual Trex1

Dual Trex1 information

anti-TREX1

YF-PA17569 100 ug
EUR 403
Description: Rabbit polyclonal to TREX1

anti-TREX1

YF-PA17570 100 ug
EUR 403
Description: Rabbit polyclonal to TREX1

anti-TREX1

YF-PA25781 50 ul
EUR 334
Description: Mouse polyclonal to TREX1

TREX1 Conjugated Antibody

C49888 100ul
EUR 397

TREX1 Conjugated Antibody

C39174 100ul
EUR 397

Polyclonal TREX1 Antibody

APR06519G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TREX1 . This antibody is tested and proven to work in the following applications:

TREX1 cloning plasmid

CSB-CL865133HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1110
  • Sequence: atgggccctggagctcgcagacagggcaggattgtgcagggaaggcctgagatgtgcttctgcccaccccctaccccactccctccccttcggatcttaacactgggcactcacacacccaccccatgctcctctccaggctcagcagcaggtacgtacccaaccatgggctcgc
  • Show more
Description: A cloning plasmid for the TREX1 gene.

TREX1 Rabbit mAb

A3819-100ul 100 ul
EUR 410

TREX1 Rabbit mAb

A3819-200ul 200 ul
EUR 571

TREX1 Rabbit mAb

A3819-20ul 20 ul
EUR 221

TREX1 Rabbit mAb

A3819-50ul 50 ul
EUR 287

TREX1 Rabbit pAb

A6778-100ul 100 ul
EUR 308

TREX1 Rabbit pAb

A6778-200ul 200 ul
EUR 459

TREX1 Rabbit pAb

A6778-20ul 20 ul
EUR 183

TREX1 Rabbit pAb

A6778-50ul 50 ul
EUR 223

anti- TREX1 antibody

FNab08963 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • IP: 1:200-1:1000
  • Immunogen: three prime repair exonuclease 1
  • Uniprot ID: Q9NSU2
  • Gene ID: 11277
  • Research Area: Metabolism
Description: Antibody raised against TREX1

Anti-TREX1 antibody

PAab08963 100 ug
EUR 412